gene annotation

 
For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the following task.
Must include screenshots at each step

Identify the open reading frame (ORF). Must describe the frame strand, positive or negative, frame 1, 2 or 3, what it means,
List the top three hits providing statistics such as, e-value, identity score, length etc. use the top hit to describe how the query aligns with the subject including the definitions as necessary. Use screenshot to explain.
Coding Sequence (CDS) Coding regions. State the coordinates of the start and stop codon. Or state if the gene is protein coding or not
Genomic location: State the chromosome on which the gene is found and location
List of exons
What is the gene name, organism, and gene id encoded by this DNA sequence? You can use any of the genomic browsers already covered. Explain why you concluded the sequence belong to the gene you have named.

Do not cut and paste your database results to report your findings. Write two to three paragraphs reporting the information you have obtained about this gene. Imagine this is a report you will present to an employer or a group of researchers interested in this gene.

here is the sequence:
 
ATGGACGGCCCCGGGGCCAGCGCCGTGGTCGTGCGCGTCGGCATCCCGGACCTGCAGCAGACGAAGTGCC
TGCGCCTGGACCCGACCGCGCCCGTGTGGGCCGCCAAGCAGCGCGTGCTCTGCGCCCTCAACCACAGCCT
CCAGGACGCGCTCAACTATGGGCTTTTCCAGCCGCCCTCCCGGGGCCGCGCCGGCAAGTTCCTGGACGAG
GAGCGGCTCCTGCAGGACTACCCGCCTAATCTGGACACGCCCCTGCCCTACCTGGAGTTTCGATACAAGC
GGCGAGTTTATGCCCAGAACCTCATCGATGATAAGCAGTTTGCAAAGCTTCACACAAAGGCGAACCTGAA
GAAGTTCATGGACTATGTCCAGCTGCATAGCACAGACAAGGTGGCCCGCCTGCTGGACAAGGGGCTGGAC
CCCAACTTCCATGACCCTGACTCAGGAGAGTGCCCCCTGAGCCTTGCAGCCCAGCTGGACAATGCCACGG
ACCTGCTGAAGGTGCTGAAGAACGGCGGTGCCCACCTGGACTTTCGCACTCGTGATGGGCTCACTGCTGT
GCACTGTGCCACACGCCAGCGGAATGCAGCGGCATTGACGACCCTGCTGGACCTGGGGGCATCACCTGAC
TACAAGGACAGCCGCGGCTTGACACCCCTCTACCACAGCGCCCTGGGGGGTGGGGATGCCCTCTGCTGTG
AGCTGCTTCTCCACGACCATGCTCAGCTGGGGACCACCGACGAGAATGGCTGGCAGGAGATCCACCAGGC
CTGCCGCTTCGGGCACGTGCAGCACCTGGAGCACCTGCTCTTCTACGGGGCAGACATGGGGGCCCAGAAC
GCCTCAGGGAACACAGCCCTGCACATCTGTGCCCTCTACAACCAGGAGAGCTGTGCTCGTGTCCTGCTCT
TCCGTGGAGCCAACAGGGATGTGCGTAACTACAACAGCCAGACAGCCTTCCAGGTGGCCATCATCGCAGG
GAACTTTGAGCTTGCAGAGGTTATCAAGACCCACAAAGACTCGGATGTTGTACCATTCAGGGAAACTCCC
AGCTATGCGAAGCGGCGGCGACTGGCTGGCCCCAGTGGCTTGGCATCCCCTCGGCCTCTGCAGCGCTCAG
CCAGCGATATCAACCTGAAGGGGGAGGCGCAGCCGGCAGCTTCTCCTGGACCCTCGCTGAGAAGCCTCCC
CCACCAGCTGCTGCTCCAGCGGCTGCAGGAGGAGAAAGATCGTGACCGGGATGCCGACCAGGAGAGCAAC
ATCAGTGGCCCCTTAGTAGGCAGGGGCAGCCAGAGCAAGATCAGCCCGAGCGGGCCTGGCGGCCCTGGCC
CTGCGCCCGGCCCCGGCCCCGCGCCCCCCGCGCCCCCCGCGCCGCCGCCCCGGGGCCCGAAGCGGAAACT
TTACAGCGCAGTCCCCGGCCGCAAGTTCATCGCTGTGAAGGCGCACAGCCCGCAGGGCGAAGGCGAGATC
CCGCTGCACCGCGGAGAGGCCGTGAAGGTGCTCAGCATTGGGGAGGGCGGTTTCTGGGAGGGAACCGTGA
AAGGCCGCACGGGCTGGTTCCCGGCTGACTGCGTGGAGGAGGTGCAGATGAGGCAGCATGACACGAGGCC
TGAAACCCGTGAGGACCGGACAAAGCGGCTTTTTCGGCACTACACTGTGGGCTCCTACGACAGCCTCACC
TCACACAGCGATTATGTCATTGATGACAAAGTGGCCGTCCTGCAGAAACGGGACCACGAGGGCTTTGGTT
TTGTGCTCCGGGGAGCCAAAGCAGAGACCCCCATCGAGGAGTTCACGCCCACACCAGCCTTCCCAGCGCT
GCAGTATCTTGAGTCGGTGGACGTGGAGGGTGTGGCCTGGAAGGCCGGGCTTCGCACAGGAGACTTCCTC
ATTGAGGTGAATGGGGTGAACGTGGTGAAGGTTGGACACAAGCAGGTGGTAGCTCTGATCCGCCAGGGTG
GCAACCGCCTTGTCATGAAGGTTGTGTCTGTGACAAGAAAGCCGGAAGAGGATGGGGCTCGGCGCAGAGC
CCCACCGCCCCCCAAGAGGGCCCCCAGCACCACACTGACCCTGCGCTCCAAGTCCATGACAGCTGAGCTC
GAGGAACTTGCCTCCATTCGGAGAAGAAAAGGGGAGAAGCTGGACGAGATGCTGGCAGCCGCCACAGAGC
CGACGCTGAGGCCAGACATCGCAGACGCGGACTCCAGAGCCGCCACAGTCAAACAGCGGCCCACCAGTCG
GAGGATCACACCTGCTGAGATTAGTTCATTGTTTGAACGCCAGGGCCTCCCAGGCCCAGAGAAGCTGCCG
GGCTCCTTGCGGAAGGGGATTCCACGGACCAAATCTGTAGGGGAGGACGAGAAGCTGGCGTCCCTGCTGG
AAGGGCGCTTCCCGCGGAGCACGTCGATGCAAGACCCGGTGCTGCGCGAGAGTCGCGGCATCCCGCCCCC
GCCGCAGACCGCGCCGCCGCCCCCGCCCGCGCCCTACTACTTCGACTCGGGGCCGCCCCCGGCCTTCTCG
CCGCCGCCCCCGCCGGGCCGCGCCTACGACACGGTGCGCTCCAGCTTCAAGCCCGGCCTGGAGGCGCGCC
TGGGCGCGGGGGCTGCCGGCCTGTACGATCCCGGCGCGGCCCTCGGCCCGCTGCCCTACCCCGAGCGGCA
GAAGCGCGCGCGCTCCATGATCATCCTGCAGGACTCGGCGCCGGAGACGAGCGACGTCCCCCGGCCCCCG
CCCGCAGGCACCCCGCCCGAGCGCCCCAAGCGCCGGCCGCGGCCGCCCGGCCCCGACAGCCCCTATGCCA
ACCTGGGCGCCTTCAGCGCCAGCCTCTTCGCGCCGTCCAAGCCGCAGCGCCGCAAGAGCCCGCTGGTGAA
GCAGCTGCAGGTGGAGGATGCGCAGGAGCGCGCGGCCCTGGCCGTGGGCAGCCCCGGGCCCGGCGGCGGC
AGCTTCGCACGCGAGCCCTCCCCGACCCACCGTGGTCCCCGACCCGGCGGCCTCGACTACGGCGCGGGCG
ACGGCCCGGGGCTCGCGTTCGGCGGCCCGGGCCCGGCCAAGGACCGGCGGCTGGAGGAGCGGCGCCGCTC
CACTGTGTTCCTGTCCGTGGGCGCCATCGAGGGCAGCGCCCCCAGCGCGGACCTGCCATCCCTGCAGCCC
TCCCGCTCCATCGACGAGCGCCTCTTGGGCACCGGCCCCACCGCCGGCCGCGACTTGCTGCTGCCCTCCC
CGGTGTCTGCTCTGAAGCCATTGGTCAGCGGCCCGACCCTCGGGCCCTCAGGCTCCACCTTCATCCACCC
GCTCACCGGCAAACCCCTGGACCCCAGCTCACCCCTGGCCCTTGCCCTGGCTGCCCGAGAGCGGGCTCTG
GCCTCCCAGGCACCCTCCCGGTCCCCCACGCCCGTGCACAGCCCCGACGCCGACCGCCCTGGACCCCTGT
TTGTGGATGTGCAGGCCCGGGACCCAGAGCGAGGGTCCCTGGCGTCGCCAGCCTTCTCCCCGCGAAGCCC
GGCCTGGATTCCTGTGCCTGCTCGCAGGGAGGCAGAGAAGGCCCCCCGGGAGGAGCGGAAGTCACCTGAG
GACAAGAAGTCCATGATCCTCAGCGTTCTGGACACATCCCTGCAGCGGCCAGCCGGCCTCATCGTTGTGC
ATGCCACCAGCAACGGGCAGGAGCCCAGCAGGCTGGGGGCCGAAGAGGAGCGCCCGGGCACCCCGGAGTT
GGCCCCGGCCCCCATGCAGTCAGCGGCTGTGGCTGAGCCCCTGCCCAGCCCCCGGGCCCAGCCCCCTGGC
AGCACCCCGGCAGAACCTGGGCCAGGTCAGGGCAGCTCAGAGGAAGAGCCAGAGCTGGTGTTTGCTGTGA
ACCTACCACCCGCTCAGCTGTCGTCTAGCGATGAGGAGACCAGGGAGGAGCTGGCCCGGATTGGGCTGGT
GCCACCCCCAGAAGAGTTTGCCAACGGGGTCCTGCTGGCCACCCCACTCGCTGGCCCGGGCCCCTCGCCC
ACCACGGTGCCCAGCCCGGCCTCAGGGAAGCCCAGCAGTGAGCCACCCCCTGCCCCTGAGTCTGCAGCCG
ACTCCGGGGTGGAGGAGGCTGACACACGCAGCTCCAGCGACCCCCACCTGGAGACCACAAGCACCATCTC
CACGGTGTCCAGCATGTCCACCTTGAGCTCAGAGAGCGGGGAACTCACTGACACCCACACCTCCTTCGCT
GACGGACACACTTTTCTACTCGAGAAGCCACCAGTGCCTCCCAAGCCCAAGCTCAAGTCCCCGCTGGGGA
AGGGGCCGGTGACCTTCAGGGACCCGCTGCTGAAACAGTCCTCGGACAGCGAGCTTATGGCCCAGCAGCA
CCATGCCGCCTCTGCCGGGCTGGCCTCTGCCGCCGGGCCTGCCCGCCCTCGCTACCTCTTCCAGAGAAGG
TCCAAGCTATGGGGGGACCCCGTGGAGAGCCGGGGGCTCCCTGGGCCTGAAGACGACAAACCAACTGTGA
TCAGTGAACTCAGCTCCCGCCTGCAGCAGCTGAACAAAGACACGCGTTCCCTGGGGGAGGAACCAGTTGG
TGGCCTGGGCGGCCTGCTGGACCCTGTCAAGAAGTCGCCCATCGCAGCAGCTCGGCTCTTCAGCAGCCTC
GGTGAGCTGAGCTCCATTTCAGCGCAGCGCAGCCCCGGGGGCCCGGGCGGCGGGGCCTCCTACTCGGTGA
GGCCCAGCGGCCGCTACCCCGTGGCGCGACGCGCCCCGAGCCCTGTGAAGCCCGCGTCGCTGGAGCGGGT
GGAGGGGCTGGGGGCGGGCGCGGGGGGAGCAGGGCGGCCCTTCGGCCTCACGCCCCCCACCATCCTCAAG
TCGTCCAGCCTCTCCATCCCGCACGAGCCCAAGGAGGTGCGCTTCGTGGTGCGCAGCGTGAGCGCACGCA
GCCGCTCCCCCTCGCCATCGCCGCTGCCCTCGCCCGCGTCCGGCCCCGGCCCCGGCGCCCCCGGCCCGCG
CCGGCCCTTCCAGCAGAAGCCGCTGCAGCTCTGGAGCAAGTTCGACGTGGGCGACTGGCTGGAGAGCATC
CACCTGGGCGAGCACCGTGACCGCTTCGAGGACCATGAGATCGAAGGCGCGCACCTCCCCGCGCTCACCA
AGGACGACTTCGTGGAGCTGGGCGTCACGCGCGTGGGCCACCGCATGAACATCGAGCGCGCGCTCAGGCA
GCTGGACGGCAGCTGA

Calculate your paper price
Pages (550 words)
Approximate price: -

Why Choose Us

Quality Papers

We value our clients. For this reason, we ensure that each paper is written carefully as per the instructions provided by the client. Our editing team also checks all the papers to ensure that they have been completed as per the expectations.

Professional Academic Writers

Over the years, our Acme Homework has managed to secure the most qualified, reliable and experienced team of writers. The company has also ensured continued training and development of the team members to ensure that it keep up with the rising Academic Trends.

Affordable Prices

Our prices are fairly priced in such a way that ensures affordability. Additionally, you can get a free price quotation by clicking on the "Place Order" button.

On-Time delivery

We pay strict attention on deadlines. For this reason, we ensure that all papers are submitted earlier, even before the deadline indicated by the customer. For this reason, the client can go through the work and review everything.

100% Originality

At Graduate Assistants, all papers are plagiarism-free as they are written from scratch. We have taken strict measures to ensure that there is no similarity on all papers and that citations are included as per the standards set.

Customer Support 24/7

Our support team is readily available to provide any guidance/help on our platform at any time of the day/night. Feel free to contact us via the Chat window or support email: support@acmehomework.com.

Try it now!

Calculate the price of your order

We'll send you the first draft for approval by at
Total price:
$0.00

How it works?

Follow these simple steps to get your paper done

Place your order

Fill in the order form and provide all details of your assignment.

Proceed with the payment

Choose the payment system that suits you most.

Receive the final file

Once your paper is ready, we will email it to you.

Our Services

Graduate Assistants has stood as the world’s leading custom essay writing services providers. Once you enter all the details in the order form under the place order button, the rest is up to us.

Essays

Essay Writing Services

At Graduate Assistants, we prioritize on all aspects that bring about a good grade such as impeccable grammar, proper structure, zero-plagiarism and conformance to guidelines. Our experienced team of writers will help you completed your essays and other assignments.

Admissions

Admission and Business Papers

Be assured that you’ll definitely get accepted to the Master’s level program at any university once you enter all the details in the order form. We won’t leave you here; we will also help you secure a good position in your aspired workplace by creating an outstanding resume or portfolio once you place an order.

Editing

Editing and Proofreading

Our skilled editing and writing team will help you restructure you paper, paraphrase, correct grammar and replace plagiarized sections on your paper just on time. The service is geared toward eliminating any mistakes and rather enhancing better quality.

Coursework

Technical papers

We have writers in almost all fields including the most technical fields. You don’t have to worry about the complexity of your paper. Simply enter as much details as possible in the place order section.